ID: 1142881553_1142881558

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1142881553 1142881558
Species Human (GRCh38) Human (GRCh38)
Location 17:2885862-2885884 17:2885899-2885921
Sequence CCTTCCAGCATTATTGACATTGA ACTTAGGTGACCAGGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165} {0: 1, 1: 0, 2: 2, 3: 18, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!