ID: 1142994617_1142994622

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142994617 1142994622
Species Human (GRCh38) Human (GRCh38)
Location 17:3753330-3753352 17:3753378-3753400
Sequence CCATGAACGTGGTAAAATGGAGC CCATCCATGTCAATGTCCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58} {0: 1, 1: 0, 2: 2, 3: 20, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!