ID: 1143144119_1143144127

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1143144119 1143144127
Species Human (GRCh38) Human (GRCh38)
Location 17:4762587-4762609 17:4762639-4762661
Sequence CCGTCTCACAAAATAAATAAATA AGCGGCACTCCTGCTCTTCTAGG
Strand - +
Off-target summary {0: 8, 1: 2006, 2: 3325, 3: 6446, 4: 114885} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!