ID: 1143241209_1143241219

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1143241209 1143241219
Species Human (GRCh38) Human (GRCh38)
Location 17:5444695-5444717 17:5444733-5444755
Sequence CCCAGCTGGAGGAGCACGGACCA CCGCCTGTGAAGGTAGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 125} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!