ID: 1143241210_1143241221

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1143241210 1143241221
Species Human (GRCh38) Human (GRCh38)
Location 17:5444696-5444718 17:5444736-5444758
Sequence CCAGCTGGAGGAGCACGGACCAG CCTGTGAAGGTAGGGCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 143} {0: 1, 1: 0, 2: 2, 3: 48, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!