ID: 1143351599_1143351605

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1143351599 1143351605
Species Human (GRCh38) Human (GRCh38)
Location 17:6292018-6292040 17:6292053-6292075
Sequence CCCAGGTGCCTCACTCACTTCCT AAGCCAGTGTCCAGGCTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 341} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!