ID: 1143397392_1143397396

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1143397392 1143397396
Species Human (GRCh38) Human (GRCh38)
Location 17:6612065-6612087 17:6612100-6612122
Sequence CCAGAACTATATCCGCATCTAAT CTCTGCAACCTCTGGGTCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 97} {0: 1, 1: 0, 2: 42, 3: 3186, 4: 59069}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!