ID: 1143446818_1143446832

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1143446818 1143446832
Species Human (GRCh38) Human (GRCh38)
Location 17:7014770-7014792 17:7014821-7014843
Sequence CCCGAGCCGCTCAGTCTCCCTGC GCGGCGGCGGCGTCTCCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 216} {0: 1, 1: 0, 2: 4, 3: 29, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!