ID: 1143446820_1143446826

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1143446820 1143446826
Species Human (GRCh38) Human (GRCh38)
Location 17:7014776-7014798 17:7014799-7014821
Sequence CCGCTCAGTCTCCCTGCTCTCCG TGGTCCCGGCTCGCGTGTAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 58, 4: 497} {0: 1, 1: 0, 2: 0, 3: 16, 4: 789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!