ID: 1143446829_1143446839

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1143446829 1143446839
Species Human (GRCh38) Human (GRCh38)
Location 17:7014804-7014826 17:7014857-7014879
Sequence CCGGCTCGCGTGTAGCGGCGGCG CATGACGTCAGCGTCCACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27} {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!