ID: 1143683191_1143683196

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1143683191 1143683196
Species Human (GRCh38) Human (GRCh38)
Location 17:8492802-8492824 17:8492826-8492848
Sequence CCAAGTTGGAGGCGACCTGGCGC GGTGGTCCAGGTCCACCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38} {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!