ID: 1143766474_1143766478

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1143766474 1143766478
Species Human (GRCh38) Human (GRCh38)
Location 17:9141074-9141096 17:9141096-9141118
Sequence CCATTAAGTTTGAAGTGCTTTTG GAGCAATCTGAGATGTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 246} {0: 1, 1: 0, 2: 1, 3: 24, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!