ID: 1143815202_1143815212

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1143815202 1143815212
Species Human (GRCh38) Human (GRCh38)
Location 17:9507146-9507168 17:9507195-9507217
Sequence CCTGCATCCCGGATCTATGAAAC CATGCCCCCGGCCTGCCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} {0: 1, 1: 0, 2: 4, 3: 14, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!