ID: 1143904565_1143904566

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1143904565 1143904566
Species Human (GRCh38) Human (GRCh38)
Location 17:10198564-10198586 17:10198580-10198602
Sequence CCGGGAAGCAGAGACTCGTTGGC CGTTGGCTTCGCAGAGCGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 115} {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!