ID: 1144051485_1144051494

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1144051485 1144051494
Species Human (GRCh38) Human (GRCh38)
Location 17:11500787-11500809 17:11500835-11500857
Sequence CCCATCATCTCAGAAAGTGCTAT ACTTGGGTCTACAGGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 221} {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!