ID: 1144107232_1144107243

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1144107232 1144107243
Species Human (GRCh38) Human (GRCh38)
Location 17:11997260-11997282 17:11997285-11997307
Sequence CCCGGCCCCGCACTCGCCACGTC CCGCGCGCTCCCAGACGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 203} {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!