ID: 1144136700_1144136704

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1144136700 1144136704
Species Human (GRCh38) Human (GRCh38)
Location 17:12302117-12302139 17:12302135-12302157
Sequence CCATTCTCCTTCTCGGTCTCCAG TCCAGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary No data {0: 4092, 1: 106823, 2: 236369, 3: 242729, 4: 149924}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!