ID: 1144140509_1144140526

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1144140509 1144140526
Species Human (GRCh38) Human (GRCh38)
Location 17:12342782-12342804 17:12342832-12342854
Sequence CCTGAGACTCTGCCTCCTCCCCC CCTCTAGCTTTTGCTAATCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!