ID: 1144140510_1144140526

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1144140510 1144140526
Species Human (GRCh38) Human (GRCh38)
Location 17:12342794-12342816 17:12342832-12342854
Sequence CCTCCTCCCCCCATCCCTCCAGC CCTCTAGCTTTTGCTAATCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 28, 3: 308, 4: 4252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!