| ID: 1144170898_1144170905 | View in Genome Browser | 
| Spacer: 13 | 
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1144170898 | 1144170905 | 
| Species | Human (GRCh38) | Human (GRCh38) | 
| Location | 17:12658985-12659007 | 17:12659021-12659043 | 
| Sequence | CCTCTTCACCCCTCTTAAAGTGA | CCAGGAAGACGAAGAAGAAGAGG | 
| Strand | - | + | 
| Off-target summary | No data | No data | 
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||