ID: 1144211994_1144211998

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1144211994 1144211998
Species Human (GRCh38) Human (GRCh38)
Location 17:13023556-13023578 17:13023578-13023600
Sequence CCTGAGGCCTCTCTCCTTGGCTT TGCAAATGGCCTTCCTCTTGCGG
Strand - +
Off-target summary {0: 148, 1: 422, 2: 503, 3: 494, 4: 675} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!