ID: 1144211995_1144211998

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1144211995 1144211998
Species Human (GRCh38) Human (GRCh38)
Location 17:13023563-13023585 17:13023578-13023600
Sequence CCTCTCTCCTTGGCTTGCAAATG TGCAAATGGCCTTCCTCTTGCGG
Strand - +
Off-target summary {0: 12, 1: 218, 2: 733, 3: 1196, 4: 2435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!