ID: 1144214462_1144214466

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1144214462 1144214466
Species Human (GRCh38) Human (GRCh38)
Location 17:13043132-13043154 17:13043154-13043176
Sequence CCAACATGTCACATGGTGAGAGA ATGGAGCAAGAGAAAGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 45, 3: 325, 4: 2550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!