ID: 1144262530_1144262534

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1144262530 1144262534
Species Human (GRCh38) Human (GRCh38)
Location 17:13536573-13536595 17:13536602-13536624
Sequence CCTCACCATTAATGTTGCTAACT GCCCACGTTTAACACCCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 104} {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!