ID: 1144424856_1144424862

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144424856 1144424862
Species Human (GRCh38) Human (GRCh38)
Location 17:15132285-15132307 17:15132311-15132333
Sequence CCTCAATTTGAATTGACCCACCC AATTTGCATGTAATTGAAAGTGG
Strand - +
Off-target summary No data {0: 22, 1: 98, 2: 205, 3: 271, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!