ID: 1144424857_1144424864

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1144424857 1144424864
Species Human (GRCh38) Human (GRCh38)
Location 17:15132301-15132323 17:15132318-15132340
Sequence CCCACCCCTTAATTTGCATGTAA ATGTAATTGAAAGTGGGCTTAGG
Strand - +
Off-target summary {0: 19, 1: 56, 2: 74, 3: 113, 4: 282} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!