ID: 1144424858_1144424864

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1144424858 1144424864
Species Human (GRCh38) Human (GRCh38)
Location 17:15132302-15132324 17:15132318-15132340
Sequence CCACCCCTTAATTTGCATGTAAT ATGTAATTGAAAGTGGGCTTAGG
Strand - +
Off-target summary {0: 32, 1: 80, 2: 128, 3: 239, 4: 651} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!