ID: 1144424859_1144424864

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1144424859 1144424864
Species Human (GRCh38) Human (GRCh38)
Location 17:15132305-15132327 17:15132318-15132340
Sequence CCCCTTAATTTGCATGTAATTGA ATGTAATTGAAAGTGGGCTTAGG
Strand - +
Off-target summary {0: 23, 1: 105, 2: 207, 3: 313, 4: 484} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!