ID: 1144517362_1144517369

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1144517362 1144517369
Species Human (GRCh38) Human (GRCh38)
Location 17:15928049-15928071 17:15928064-15928086
Sequence CCGCCCGCCTCAGCCTCCCAAAG TCCCAAAGTGCTGGGATTATAGG
Strand - +
Off-target summary {0: 20304, 1: 108143, 2: 164903, 3: 177131, 4: 137557} {0: 27231, 1: 315676, 2: 251783, 3: 138973, 4: 131031}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!