ID: 1144517364_1144517373

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1144517364 1144517373
Species Human (GRCh38) Human (GRCh38)
Location 17:15928053-15928075 17:15928089-15928111
Sequence CCGCCTCAGCCTCCCAAAGTGCT TGAGCCACCACGCCCGGCCGAGG
Strand - +
Off-target summary {0: 60215, 1: 147830, 2: 155736, 3: 113395, 4: 79914} {0: 25, 1: 626, 2: 2978, 3: 6264, 4: 7998}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!