ID: 1144517366_1144517373

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1144517366 1144517373
Species Human (GRCh38) Human (GRCh38)
Location 17:15928056-15928078 17:15928089-15928111
Sequence CCTCAGCCTCCCAAAGTGCTGGG TGAGCCACCACGCCCGGCCGAGG
Strand - +
Off-target summary {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692} {0: 25, 1: 626, 2: 2978, 3: 6264, 4: 7998}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!