ID: 1144517368_1144517373

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1144517368 1144517373
Species Human (GRCh38) Human (GRCh38)
Location 17:15928062-15928084 17:15928089-15928111
Sequence CCTCCCAAAGTGCTGGGATTATA TGAGCCACCACGCCCGGCCGAGG
Strand - +
Off-target summary {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448} {0: 25, 1: 626, 2: 2978, 3: 6264, 4: 7998}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!