ID: 1144694740_1144694748

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1144694740 1144694748
Species Human (GRCh38) Human (GRCh38)
Location 17:17295144-17295166 17:17295177-17295199
Sequence CCGGCCTCATTCTCTTTTTTCTT CCTCACTCTGTTGCCCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 37, 3: 488, 4: 4263} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!