ID: 1144722752_1144722757

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1144722752 1144722757
Species Human (GRCh38) Human (GRCh38)
Location 17:17483595-17483617 17:17483640-17483662
Sequence CCGCAGTTGAATGAAAAATTAAA AAGAATGAGGAAAGGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 64, 4: 723} {0: 1, 1: 1, 2: 20, 3: 284, 4: 2946}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!