ID: 1144802000_1144802006

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144802000 1144802006
Species Human (GRCh38) Human (GRCh38)
Location 17:17935710-17935732 17:17935736-17935758
Sequence CCAATGATGCCATCATGCTCCAA CCATTAGGACATAAGGAACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 170} {0: 1, 1: 0, 2: 1, 3: 4, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!