ID: 1144849654_1144849663

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1144849654 1144849663
Species Human (GRCh38) Human (GRCh38)
Location 17:18237635-18237657 17:18237687-18237709
Sequence CCCGTGTCCTGGTGCAGTGCCTG CCACACCGAGTGGAGCCTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 387} {0: 1, 1: 0, 2: 2, 3: 7, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!