ID: 1144862674_1144862685

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1144862674 1144862685
Species Human (GRCh38) Human (GRCh38)
Location 17:18315330-18315352 17:18315375-18315397
Sequence CCGGGTTGTGGCGTCCTAGGAGC CAGTGAGGGGCAGCAGCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 59} {0: 1, 1: 0, 2: 4, 3: 30, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!