|
Left Crispr |
Right Crispr |
| Crispr ID |
1144923421 |
1144923426 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:18782966-18782988
|
17:18783014-18783036
|
| Sequence |
CCCAGCTCCTATTGAAGATGGAG |
ATTTGAACCTGCGCCCAGGCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 323, 2: 745, 3: 735, 4: 567} |
{0: 2, 1: 0, 2: 0, 3: 8, 4: 109} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|