ID: 1144926808_1144926813

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1144926808 1144926813
Species Human (GRCh38) Human (GRCh38)
Location 17:18818435-18818457 17:18818456-18818478
Sequence CCTTCCCATTGTCAGTGCATGAC ACCCAGTGCCGGGCACCTAATGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 13, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!