ID: 1144938151_1144938155

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1144938151 1144938155
Species Human (GRCh38) Human (GRCh38)
Location 17:18916792-18916814 17:18916812-18916834
Sequence CCTGAGGTGGCACCTTGTTACTG CTGTGTCCTCAGATGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 110} {0: 7, 1: 285, 2: 807, 3: 1675, 4: 2421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!