ID: 1145190799_1145190808

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1145190799 1145190808
Species Human (GRCh38) Human (GRCh38)
Location 17:20841488-20841510 17:20841518-20841540
Sequence CCGACATCGACGCCGCCTGGCAG GCACCAGGTGAGGGCGACCCTGG
Strand - +
Off-target summary {0: 5, 1: 7, 2: 0, 3: 3, 4: 61} {0: 10, 1: 1, 2: 0, 3: 23, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!