ID: 1145190814_1145190823

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1145190814 1145190823
Species Human (GRCh38) Human (GRCh38)
Location 17:20841535-20841557 17:20841561-20841583
Sequence CCCTGGGGGCAGCTCAGCCTGGG ACCCAAGAGGGGACCAGGCCGGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 9, 3: 60, 4: 426} {0: 2, 1: 8, 2: 4, 3: 29, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!