|
Left Crispr |
Right Crispr |
| Crispr ID |
1145190814 |
1145190832 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:20841535-20841557
|
17:20841571-20841593
|
| Sequence |
CCCTGGGGGCAGCTCAGCCTGGG |
GGACCAGGCCGGGGGCCGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 1, 2: 9, 3: 60, 4: 426} |
{0: 3, 1: 5, 2: 5, 3: 69, 4: 849} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|