ID: 1145275500_1145275503

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1145275500 1145275503
Species Human (GRCh38) Human (GRCh38)
Location 17:21426962-21426984 17:21426983-21427005
Sequence CCATTTAAAAAGGACAAAAATCA CAGAGCCCAGTCCCAGGCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 9, 3: 127, 4: 1330} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!