ID: 1145761254_1145761264

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1145761254 1145761264
Species Human (GRCh38) Human (GRCh38)
Location 17:27426415-27426437 17:27426467-27426489
Sequence CCAGCCTGGAAGGGCCAGGTCCT TCGGGCTCACCCCGTGCCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!