ID: 1145886303_1145886314

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1145886303 1145886314
Species Human (GRCh38) Human (GRCh38)
Location 17:28384654-28384676 17:28384688-28384710
Sequence CCGCGGCGCCAGGGTCGCTTTTG CCTGTACGCAGCCACCGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70} {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!