|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927666 |
1145927670 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659711-28659733
|
17:28659737-28659759
|
| Sequence |
CCCAGACGGGGTGGCGGCCGGGC |
GGCCCTCCTCATATCCCAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1254, 1: 2879, 2: 4285, 3: 2853, 4: 1827} |
{0: 1, 1: 10, 2: 1043, 3: 1584, 4: 6799} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|