ID: 1145927666_1145927673

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1145927666 1145927673
Species Human (GRCh38) Human (GRCh38)
Location 17:28659711-28659733 17:28659739-28659761
Sequence CCCAGACGGGGTGGCGGCCGGGC CCCTCCTCATATCCCAGACGGGG
Strand - +
Off-target summary {0: 1254, 1: 2879, 2: 4285, 3: 2853, 4: 1827} {0: 1, 1: 8, 2: 752, 3: 4349, 4: 4420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!