|
Left Crispr |
Right Crispr |
| Crispr ID |
1145927666 |
1145927675 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:28659711-28659733
|
17:28659742-28659764
|
| Sequence |
CCCAGACGGGGTGGCGGCCGGGC |
TCCTCATATCCCAGACGGGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1254, 1: 2879, 2: 4285, 3: 2853, 4: 1827} |
{0: 7, 1: 750, 2: 3795, 3: 5681, 4: 8373} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|