|
Left Crispr |
Right Crispr |
Crispr ID |
1145927667 |
1145927675 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:28659712-28659734
|
17:28659742-28659764
|
Sequence |
CCAGACGGGGTGGCGGCCGGGCA |
TCCTCATATCCCAGACGGGGCGG |
Strand |
- |
+ |
Off-target summary |
{0: 1163, 1: 2416, 2: 2885, 3: 2217, 4: 1432} |
{0: 7, 1: 750, 2: 3795, 3: 5681, 4: 8373} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|